All Decal IDs
Broad verified decal ID discovery with copy-ready image codes.
Curated
Higher-signal decal IDs from curated sources and ranking checks.
Categories
Browse decal IDs by image style, theme, and common use.
Game Specific
Image IDs selected for the custom-image features in Roblox games.
wallpaper goti 1920x1080
by caacaucauacauuaccaaa
Decal ID109267693674374
Jan 2, 2026 · 0%
jujutsu-kaisen-grimacing-satoru-gojo-wallpaper
by Icepopjr1259
Decal ID110109563856910
Feb 22, 2026 · 0%
Minecraft Dirt Block Texture Pixel Art
by Emanuel_ativo1
Decal ID99572668218561
Feb 26, 2026 · 0%
Hello neighbor pre alpha wallpaper
by Izachattak98
Decal ID100950153615428
Jun 3, 2025 · 0%
—Pngtree—street art graffiti vector letterin
by ianatidis123456
Decal ID101941608384173
Feb 15, 2026 · 0%